Online Inquiry
USP46 Knockout Cell Line
SPL-03926
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | USP46 |
| Gene Abbr. | USP46 |
| Gene ID | 64854 |
| Full Name | ubiquitin specific peptidase 46 |
| Species | Human |
| Genomic Locus | chr4:52628091 |
| Transcript | NM_022832 |
| WT Expression Level | 23.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP46 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Jun 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of USP46. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACACATTCTCCCGGAATGGA |
| PCR Primer |
Forward: TTCATTTCTCTGTGGATCAGATGGT Reverse: TCAGCCTTGAAATGAACTTCTTTGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.