Online Inquiry
USP45 Knockout Cell Line
SPL-03925
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp insertion |
Target Information | |
---|---|
Target Name | USP45 |
Gene Abbr. | USP45 |
Gene ID | 85015 |
Full Name | ubiquitin specific peptidase 45 |
Alias | LCA19 |
Species | Human |
Genomic Locus | chr6:99508620 |
Transcript | NM_001080481 |
WT Expression Level | 14.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of USP45. |
Description | 2bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | ATTTGGTTGTGCCTCAAGTG |
PCR Primer |
Forward: TGCAAATAGGTTGAATTACCTCTGC Reverse: CATGCTATCAGCGTGAATCATGTAA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.