USP45 Knockout Cell Line - CD BioSciences

service-banner

USP45 Knockout Cell Line

USP45 Knockout Cell Line

SPL-03925

Size Price
1 Unit Online Inquiry
Description
2bp insertion
Target Information
Target Name USP45
Gene Abbr. USP45
Gene ID 85015
Full Name ubiquitin specific peptidase 45
Alias LCA19
Species Human
Genomic Locus chr6:99508620
Transcript NM_001080481
WT Expression Level 14.71 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a deubiquitylase that binds ERCC1, the catalytic subunit of the XPF-ERCC1 DNA repair endonuclease. This endonuclease is a critical regulator of DNA repair processes, and the deubiquitylase activity of the encoded protein is important for maintaining the DNA repair ability of XPF-ERCC1. [provided by RefSeq, Sep 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of USP45.
Description 2bp insertion
Parental Cell Line C631
Guide RNA Sequence ATTTGGTTGTGCCTCAAGTG
PCR Primer Forward: TGCAAATAGGTTGAATTACCTCTGC
Reverse: CATGCTATCAGCGTGAATCATGTAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.