Online Inquiry
USP4 Knockout Cell Line
SPL-03918
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | USP4 |
Gene Abbr. | USP4 |
Gene ID | 7375 |
Full Name | ubiquitin specific peptidase 4 |
Alias | UNP, Unph |
Species | Human |
Genomic Locus | chr3:49335483 |
Transcript | NM_003363 |
WT Expression Level | 15.97 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a protease that deubiquitinates target proteins such as ADORA2A and TRIM21. The encoded protein shuttles between the nucleus and cytoplasm and is involved in maintaining operational fidelity in the endoplasmic reticulum. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of USP4. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CCTGGCCCAATAGACAACTC |
PCR Primer |
Forward: TTGCAAAGACTTCTGCTATAGATGC Reverse: AAGATTAAGGAAGCAGCTGCAGAAA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.