Online Inquiry
USP33 Knockout Cell Line
SPL-03912
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 175bp insertion |
| Target Information | |
|---|---|
| Target Name | USP33 |
| Gene Abbr. | USP33 |
| Gene ID | 23032 |
| Full Name | ubiquitin specific peptidase 33 |
| Alias | VDU1 |
| Species | Human |
| Genomic Locus | chr1:77739369 |
| Transcript | NM_201624 |
| WT Expression Level | 43.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a deubiquinating enzyme important in a variety of processes, including Slit-dependent cell migration and beta-2 adrenergic receptor signaling. The protein is negatively regulated through ubiquitination by von Hippel-Lindau tumor protein (VHL). Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 175bp insertion in a coding exon of USP33. |
| Description | 175bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACCATACTCGAAGAGTGGTA |
| PCR Primer |
Forward: ACAGGTTAGGCAGTATTCCTTTTGA Reverse: CTCATCAAAGGCAAGCAGTTTATCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.