USP28 Knockout Cell Line - CD BioSciences

service-banner

USP28 Knockout Cell Line

USP28 Knockout Cell Line

SPL-03899

Size Price
1 Unit Online Inquiry
Description
10bp deletion
Target Information
Target Name USP28
Gene Abbr. USP28
Gene ID 57646
Full Name ubiquitin specific peptidase 28
Species Human
Genomic Locus chr11:113852550
Transcript NM_020886
WT Expression Level 24.37 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of USP28.
Description 10bp deletion
Parental Cell Line C631
Guide RNA Sequence TGTAGCAACAGTGTCTTGAC
PCR Primer Forward: ACCTACTGTCCACCATAGTCTCATA
Reverse: TGACAGGGAACTCACATATACTTGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.