Online Inquiry
USP27X Knockout Cell Line
SPL-03898
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | USP27X |
| Gene Abbr. | USP27X |
| Gene ID | 389856 |
| Full Name | ubiquitin specific peptidase 27 X-linked |
| Alias | MRX105, USP22L, USP27 |
| Species | Human |
| Genomic Locus | chrX:49880521 |
| Transcript | NM_001145073 |
| WT Expression Level | 6.11 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the peptidase protein family. The encoded protein functions as a deubiquitinase that is involved in upregulation of the pro-apoptotic Bim protein. This protein may act as a tumor suppressor by increasing levels of Bim to counteract anti-apoptotic signals in cancer cells. Mutations in this gene have been associated with X-linked mental retardation. [provided by RefSeq, Dec 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of USP27X. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGCTTTACGATCGGTTTAAG |
| PCR Primer |
Forward: CAGTAACTTATAGGGCACATGAGGA Reverse: GAAGAGCAAGGAGAAGCTTTGAAAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.