USP21 Knockout Cell Line - CD BioSciences

service-banner

USP21 Knockout Cell Line

USP21 Knockout Cell Line

SPL-03892

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name USP21
Gene Abbr. USP21
Gene ID 27005
Full Name ubiquitin specific peptidase 21
Alias USP16, USP23
Species Human
Genomic Locus chr1:161160689
Transcript NM_012475
WT Expression Level 13.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of USP21.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence GTTAATATCCAGCCCCGAGT
PCR Primer Forward: CAACCACCTAATGTGGAAATGAGAG
Reverse: CTCCAGTTTCTTGAGCCGTTCATC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.