Online Inquiry
USP20 Knockout Cell Line
SPL-03888
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
22bp deletion |
Target Information | |
---|---|
Target Name | USP20 |
Gene Abbr. | USP20 |
Gene ID | 10868 |
Full Name | ubiquitin specific peptidase 20 |
Alias | LSFR3A, VDU2, hVDU2 |
Species | Human |
Genomic Locus | chr9:129856340 |
Transcript | NM_006676 |
WT Expression Level | 9.78 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of USP20. |
Description | 22bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TGCAGACAGGCCCATAGGTT |
PCR Primer |
Forward: ACAGTAAAGTATAAAGTGCTCCCCT Reverse: CCACTAGGGATGGAAGTTCCCAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.