Online Inquiry
USP2 Knockout Cell Line
SPL-03887
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 26bp deletion |
| Target Information | |
|---|---|
| Target Name | USP2 |
| Gene Abbr. | USP2 |
| Gene ID | 9099 |
| Full Name | ubiquitin specific peptidase 2 |
| Alias | UBP41, USP9 |
| Species | Human |
| Genomic Locus | chr11:119359240 |
| Transcript | NM_004205 |
| WT Expression Level | 3.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of USP2. |
| Description | 26bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGATACGCACCGCGCTTTGT |
| PCR Primer |
Forward: CTTACTTACGGAAGATGATCGAGGT Reverse: CCTGTACACTCTCTCCTTCCAATAG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.