USP2 Knockout Cell Line - CD BioSciences

service-banner

USP2 Knockout Cell Line

USP2 Knockout Cell Line

SPL-03886

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name USP2
Gene Abbr. USP2
Gene ID 9099
Full Name ubiquitin specific peptidase 2
Alias UBP41, USP9
Species Human
Genomic Locus chr11:119359241
Transcript NM_004205
WT Expression Level 3.59 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of USP2.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence CAAAGCGCGGTGCGTATCTC
PCR Primer Forward: CTTACTTACGGAAGATGATCGAGGT
Reverse: CCTGTACACTCTCTCCTTCCAATAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.