Online Inquiry
USP19 Knockout Cell Line
SPL-03882
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
25bp deletion |
Target Information | |
---|---|
Target Name | USP19 |
Gene Abbr. | USP19 |
Gene ID | 10869 |
Full Name | ubiquitin specific peptidase 19 |
Alias | ZMYND9 |
Species | Human |
Genomic Locus | chr3:49119052 |
Transcript | NM_001199161 |
WT Expression Level | 33.27 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. This protein is a ubiquitin protein ligase and plays a role in muscle wasting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2017]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of USP19. |
Description | 25bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCAGAAGGATCGAGCAAACC |
PCR Primer |
Forward: GTGATCACTGGCTTCTTTCCATTAG Reverse: AGAAGAACAAGAAAGTCATCTCCCA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.