USP19 Knockout Cell Line - CD BioSciences

service-banner

USP19 Knockout Cell Line

USP19 Knockout Cell Line

SPL-03882

Size Price
1 Unit Online Inquiry
Description
25bp deletion
Target Information
Target Name USP19
Gene Abbr. USP19
Gene ID 10869
Full Name ubiquitin specific peptidase 19
Alias ZMYND9
Species Human
Genomic Locus chr3:49119052
Transcript NM_001199161
WT Expression Level 33.27 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. This protein is a ubiquitin protein ligase and plays a role in muscle wasting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2017].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of USP19.
Description 25bp deletion
Parental Cell Line C631
Guide RNA Sequence GCAGAAGGATCGAGCAAACC
PCR Primer Forward: GTGATCACTGGCTTCTTTCCATTAG
Reverse: AGAAGAACAAGAAAGTCATCTCCCA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.