Online Inquiry
USP16 Knockout Cell Line
SPL-03854
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
8bp deletion |
Target Information | |
---|---|
Target Name | USP16 |
Gene Abbr. | USP16 |
Gene ID | 10600 |
Full Name | ubiquitin specific peptidase 16 |
Alias | UBP-M, UBPM |
Species | Human |
Genomic Locus | chr21:29036307 |
Transcript | NM_006447 |
WT Expression Level | 35.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a deubiquitinating enzyme that is phosphorylated at the onset of mitosis and then dephosphorylated at the metaphase/anaphase transition. It can deubiquitinate H2A, one of two major ubiquitinated proteins of chromatin, in vitro and a mutant form of the protein was shown to block cell division. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of USP16. |
Description | 8bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TTCAAACCAGTTGGGTCAAG |
PCR Primer |
Forward: AAGTTGGCAGTTACACACTTTGATT Reverse: TCAGCTGTATGTAATGCTAGGTAGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.