Online Inquiry
USP15 Knockout Cell Line
SPL-03850
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
32bp deletion |
Target Information | |
---|---|
Target Name | USP15 |
Gene Abbr. | USP15 |
Gene ID | 9958 |
Full Name | ubiquitin specific peptidase 15 |
Alias | UNPH-2, UNPH4 |
Species | Human |
Genomic Locus | chr12:62260431 |
Transcript | NM_006313 |
WT Expression Level | 30.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the ubiquitin specific protease (USP) family of deubiquitinating enzymes. USP enzymes play critical roles in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. The encoded protein associates with the COP9 signalosome, and also plays a role in transforming growth factor beta signalling through deubiquitination of receptor-activated SMAD transcription factors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 2. [provided by RefSeq, Nov 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 32bp deletion in a coding exon of USP15. |
Description | 32bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGGCGGATCTGGACACCCAG |
PCR Primer |
Forward: ACCCTCATCTAGAGTCCAACCTTT Reverse: CTCCCGGTGTCTTTTGGTTT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.