Online Inquiry
USP14 Knockout Cell Line
SPL-03847
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 62bp insertion |
| Target Information | |
|---|---|
| Target Name | USP14 |
| Gene Abbr. | USP14 |
| Gene ID | 9097 |
| Full Name | ubiquitin specific peptidase 14 |
| Alias | TGT |
| Species | Human |
| Genomic Locus | chr18:163382 |
| Transcript | NM_005151 |
| WT Expression Level | 107.46 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 62bp insertion in a coding exon of USP14. |
| Description | 62bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTCAGCTGTTTGCGTTGAC |
| PCR Primer |
Forward: CACCATAGCTGACATACTCTCATCA Reverse: GACATGTTTTGACTCCCGATAACTG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.