USP12 Knockout Cell Line - CD BioSciences

service-banner

USP12 Knockout Cell Line

USP12 Knockout Cell Line

SPL-03844

Size Price
1 Unit Online Inquiry
Description
19bp deletion
Target Information
Target Name USP12
Gene Abbr. USP12
Gene ID 219333
Full Name ubiquitin specific peptidase 12
Alias UBH1, USP12L1
Species Human
Genomic Locus chr13:27116529
Transcript NM_182488
WT Expression Level 14.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of USP12.
Description 19bp deletion
Parental Cell Line C631
Guide RNA Sequence CCGGTCAATGAGCACTATTT
PCR Primer Forward: CTCCATCGTAATGTGATAGGACCAT
Reverse: TTCCCAATCAAGTCTCTTAGCATTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.

We use cookies to understand how you use our site and to improve the overall user experience. This includes personalizing content and advertising. Read our Privacy Policy

Accept Cookies
x