USP11 Knockout Cell Line - CD BioSciences

service-banner

USP11 Knockout Cell Line

USP11 Knockout Cell Line

SPL-03841

Size Price
1 Unit Online Inquiry
Description
229bp insertion
Target Information
Target Name USP11
Gene Abbr. USP11
Gene ID 8237
Full Name ubiquitin specific peptidase 11
Alias UHX1
Species Human
Genomic Locus chrX:47239097
Transcript NM_004651
WT Expression Level 55.51 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. This gene encodes a deubiquitinating enzyme which lies in a gene cluster on chromosome Xp11.23 [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 229bp insertion in a coding exon of USP11.
Description 229bp insertion
Parental Cell Line C631
Guide RNA Sequence GCAGTGGGAGGCATACGTGC
PCR Primer Forward: TGAGTTTCACTGAATAAATTTTGCTTCG
Reverse: TTATGATCATCTGTAGGGACGGAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.