Online Inquiry
USP10 Knockout Cell Line
SPL-03839
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | USP10 |
| Gene Abbr. | USP10 |
| Gene ID | 9100 |
| Full Name | ubiquitin specific peptidase 10 |
| Alias | UBPO |
| Species | Human |
| Genomic Locus | chr16:84745542 |
| Transcript | NM_005153 |
| WT Expression Level | 214.34 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Ubiquitin is a highly conserved protein that is covalently linked to other proteins to regulate their function and degradation. This gene encodes a member of the ubiquitin-specific protease family of cysteine proteases. The enzyme specifically cleaves ubiquitin from ubiquitin-conjugated protein substrates. The protein is found in the nucleus and cytoplasm. It functions as a co-factor of the DNA-bound androgen receptor complex, and is inhibited by a protein in the Ras-GTPase pathway. The human genome contains several pseudogenes similar to this gene. Several transcript variants, some protein-coding and others not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of USP10. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACATAGGCCACCGGCGAGG |
| PCR Primer |
Forward: ACTGAAAACCTTGGAGTTGCTAATG Reverse: GCTCCCATCTTCACTCTAGATTTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.