USP1 Knockout Cell Line - CD BioSciences

service-banner

USP1 Knockout Cell Line

USP1 Knockout Cell Line

SPL-03838

Size Price
1 Unit Online Inquiry
Description
5bp deletion
Target Information
Target Name USP1
Gene Abbr. USP1
Gene ID 7398
Full Name ubiquitin specific peptidase 1
Alias UBP
Species Human
Genomic Locus chr1:62441555
Transcript NM_003368
WT Expression Level 91.57 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. The protein specifically deubiquitinates a protein in the Fanconi anemia (FA) DNA repair pathway. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 5bp deletion in a coding exon of USP1.
Description 5bp deletion
Parental Cell Line C631
Guide RNA Sequence TTTGTGGGACTGAATAATCT
PCR Primer Forward: GGCATATAGCAATTTTTGAGCCTGT
Reverse: AGGCAAAGACAGTATGGACATTAAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.