Online Inquiry
ULK4 Knockout Cell Line
SPL-03831
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 19bp deletion |
| Target Information | |
|---|---|
| Target Name | ULK4 |
| Gene Abbr. | ULK4 |
| Gene ID | 54986 |
| Full Name | unc-51 like kinase 4 |
| Alias | FAM7C1, REC01035 |
| Species | Human |
| Genomic Locus | chr3:41954689 |
| Transcript | NM_017886 |
| WT Expression Level | 2.82 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 19bp deletion in a coding exon of ULK4. |
| Description | 19bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTCTATAAAGGGCGACGGAA |
| PCR Primer |
Forward: GAAAATGCTACCCCCTTCTACCTAT Reverse: CTTCTTAGGAGCTAGAGATGCTGTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.