UGCG Knockout Cell Line - CD BioSciences

service-banner

UGCG Knockout Cell Line

UGCG Knockout Cell Line

SPL-03825

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name UGCG
Gene Abbr. UGCG
Gene ID 7357
Full Name UDP-glucose ceramide glucosyltransferase
Alias GCS, GLCT1
Species Human
Genomic Locus chr9:111914681
Transcript NM_003358
WT Expression Level 10.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of UGCG.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TTAGGATCTACCCCTTTCAG
PCR Primer Forward: TAGCTTGTCAGTGCTTTGATTTGAC
Reverse: TTTACACCCCTTCCTCAACCTATTT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.