UCP1 Knockout Cell Line - CD BioSciences

service-banner

UCP1 Knockout Cell Line

UCP1 Knockout Cell Line

SPL-03824

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name UCP1
Gene Abbr. UCP1
Gene ID 7350
Full Name uncoupling protein 1
Alias SLC25A7, UCP
Species Human
Genomic Locus chr4:140567945
Transcript NM_021833
WT Expression Level 2.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of UCP1.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence GCCCGACGTCCAGTGTTATT
PCR Primer Forward: GTTATGAAAACCACTCCTCTGTGTG
Reverse: ATGTTGCTGAGAAAAGAAACGGAAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.