Online Inquiry
UCHL1 Knockout Cell Line
SPL-03819
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 11bp deletion |
| Target Information | |
|---|---|
| Target Name | UCHL1 |
| Gene Abbr. | UCHL1 |
| Gene ID | 7345 |
| Full Name | ubiquitin C-terminal hydrolase L1 |
| Alias | HEL-117, HEL-S-53, NDGOA, PARK5, PGP 9.5 |
| Species | Human |
| Genomic Locus | chr4:41260711 |
| Transcript | NM_004181 |
| WT Expression Level | 537.53 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the peptidase C12 family. This enzyme is a thiol protease that hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. This gene is specifically expressed in the neurons and in cells of the diffuse neuroendocrine system. Mutations in this gene may be associated with Parkinson disease.[provided by RefSeq, Sep 2009]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 11bp deletion in a coding exon of UCHL1. |
| Description | 11bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACTTCATGAAGCAGACCATT |
| PCR Primer |
Forward: ATCCCACTGGTGTTTCCATTTAGTT Reverse: GAGGACTGTGAGTCAGATTAAGTGT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.