UBE2Z Knockout Cell Line - CD BioSciences

service-banner

UBE2Z Knockout Cell Line

UBE2Z Knockout Cell Line

SPL-03815

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name UBE2Z
Gene Abbr. UBE2Z
Gene ID 65264
Full Name ubiquitin conjugating enzyme E2 Z
Alias HOYS7, USE1
Species Human
Genomic Locus chr17:48910842
Transcript NM_023079
WT Expression Level 42.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an enzyme which ubiquitinates proteins which participate in signaling pathways and apoptosis. [provided by RefSeq, Feb 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of UBE2Z.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence TCAGGTACAACGAACATTCC
PCR Primer Forward: TCATTGAGGTGATAACAACTGTCCT
Reverse: AATAACAGACACCTCTTCAAAGTGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.