UBE2Q1 Knockout Cell Line - CD BioSciences

service-banner

UBE2Q1 Knockout Cell Line

UBE2Q1 Knockout Cell Line

SPL-03812

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name UBE2Q1
Gene Abbr. UBE2Q1
Gene ID 55585
Full Name ubiquitin conjugating enzyme E2 Q1
Alias GTAP, NICE-5, NICE5, PRO3094, UBE2Q
Species Human
Genomic Locus chr1:154555921
Transcript NM_017582
WT Expression Level 37.49 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is 98% identical to the mouse counterpart. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of UBE2Q1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TCAGACTCCACCGACCAGAT
PCR Primer Forward: CTAAATGTTTAGCTGTGTACCGTCC
Reverse: AAGTTGGGCTTTTATGTGTGTGTAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.