Online Inquiry
UBE2L6 Knockout Cell Line
SPL-03805
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | UBE2L6 |
| Gene Abbr. | UBE2L6 |
| Gene ID | 9246 |
| Full Name | ubiquitin conjugating enzyme E2 L6 |
| Alias | RIG-B, UBCH8 |
| Species | Human |
| Genomic Locus | chr11:57554510 |
| Transcript | NM_004223 |
| WT Expression Level | 15.44 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s) and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of UBE2L6. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACGTTGGGGTGGTAGATCT |
| PCR Primer |
Forward: CCTCTCCAGTAATCTCTACCCAGTA Reverse: AATTGTCAAATGAATGCAGGTGCT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.