Online Inquiry
UBE2K Knockout Cell Line
SPL-03803
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
22bp deletion |
Target Information | |
---|---|
Target Name | E2-25K/Hip2 |
Gene Abbr. | UBE2K |
Gene ID | 3093 |
Full Name | ubiquitin conjugating enzyme E2 K |
Alias | E2-25K, HIP2, HYPG, LIG, UBC1 |
Species | Human |
Genomic Locus | chr4:39755698 |
Transcript | NM_005339 |
WT Expression Level | 226.06 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene belongs to the ubiquitin-conjugating enzyme family. This protein interacts with RING finger proteins, and it can ubiquitinate huntingtin, the gene product for Huntington's disease. Known functions for this protein include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of UBE2K. |
Description | 22bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CGTCACAGGGGCTATTTGTT |
PCR Primer |
Forward: TAGTGACAACATTCAGCTTACTGGA Reverse: AGTTACTGCCCAAACAAGATAAAGT |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.