Online Inquiry
UBE2H Knockout Cell Line
SPL-03798
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | UBE2H |
| Gene Abbr. | UBE2H |
| Gene ID | 7328 |
| Full Name | ubiquitin conjugating enzyme E2 H |
| Alias | E2-20K, GID3, UBC8, UBCH, UBCH2 |
| Species | Human |
| Genomic Locus | chr7:129839251 |
| Transcript | NM_003344 |
| WT Expression Level | 57.56 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Feb 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of UBE2H. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGCAGCGTCACCATTGAG |
| PCR Primer |
Forward: GATTCTAAATCGCAAAGGATGAGCA Reverse: ATTTTAGGTGAACTTGCATTTCCCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.