Online Inquiry
UBE2D2 Knockout Cell Line
SPL-03784
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | UBE2D2 |
Gene Abbr. | UBE2D2 |
Gene ID | 7322 |
Full Name | ubiquitin conjugating enzyme E2 D2 |
Alias | E2(17)KB2, PUBC1, UBC4, UBC4/5, UBCH4 |
Species | Human |
Genomic Locus | chr5:139614747 |
Transcript | NM_003339 |
WT Expression Level | 208.85 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Regulated degradation of misfolded, damaged or short-lived proteins in eukaryotes occurs via the ubiquitin (Ub)-proteasome system (UPS). An integral part of the UPS system is the ubiquitination of target proteins and covalent linkage of Ub-containing proteins to form polymeric chains, marking them as targets for 26S proteasome-mediated degradation. Ubiquitination of proteins is mediated by a cascade of enzymes which includes E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligases) enzymes. This gene encodes a member of the E2 enzyme family. Substrates of this enzyme include the tumor suppressor protein p53 and peroxisomal biogenesis factor 5 (PEX5). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of UBE2D2. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GTTTGAAGGGGTAATCTGTT |
PCR Primer |
Forward: AATGGGGCCAGTAAGTATTCAGATT Reverse: TTGAAATAGTTAGTGCTGGAGACCA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.