Online Inquiry
TYK2 cDNA ORF Clone, Human, untagged
SPD-15349
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human tyrosine kinase 2 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Tyk2 |
| Gene Abbr. | TYK2 |
| Gene ID | 7297 |
| Full Name | tyrosine kinase 2 |
| Alias | IMD35, JTK1 |
| Introduction | Tyk2 is a member of the Jak family of protein tyrosine kinases. It associates with and is activated by receptors for many cytokines including IL-13, the IL-6 family, IL-10, and IFN-α and β. Following ligand binding, Tyk2 is activated by phosphorylation of Tyr1054 and/or Tyr1055. Tyk2 is required for the tyrosine phosphorylation of Stat3 in the IFN-β signaling cascade. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human tyrosine kinase 2 |
| NCBI Ref Seq | NM_003331.4 |
| RefSeq ORF Size | 3564 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 3.56kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.