TUBB1 Knockout Cell Line - CD BioSciences

service-banner

TUBB1 Knockout Cell Line

TUBB1 Knockout Cell Line

SPL-03766

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name TUBB1
Gene Abbr. TUBB1
Gene ID 81027
Full Name tubulin beta 1 class VI
Species Human
Genomic Locus chr20:59022906
Transcript NM_030773
WT Expression Level 0.55 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of TUBB1.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TCTCTCCAGCTGCAAGGCCG
PCR Primer Forward: CTTGGGAATGCTAACTTTCTCTGTG
Reverse: ATCACTGCTTTGACATTTCCATCTC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.