Online Inquiry
TUBA1A Knockout Cell Line
SPL-03762
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 140bp insertion |
| Target Information | |
|---|---|
| Target Name | TUBA1A |
| Gene Abbr. | TUBA1A |
| Gene ID | 7846 |
| Full Name | tubulin alpha 1a |
| Alias | B-ALPHA-1, LIS3, TUBA3 |
| Species | Human |
| Genomic Locus | chr12:49186669 |
| Transcript | NM_006009 |
| WT Expression Level | 281.58 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulins. The genes encoding these microtubule constituents belong to the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and is highly similar to the mouse and rat Tuba1 genes. Northern blotting studies have shown that the gene expression is predominantly found in morphologically differentiated neurologic cells. This gene is one of three alpha-tubulin genes in a cluster on chromosome 12q. Mutations in this gene cause lissencephaly type 3 (LIS3) - a neurological condition characterized by microcephaly, mental retardation, and early-onset epilepsy and caused by defective neuronal migration. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 140bp insertion in a coding exon of TUBA1A. |
| Description | 140bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | ACACCTTCTTCAGTGAGACG |
| PCR Primer |
Forward: GAACTTCATCTGGAGAACATGATGG Reverse: GCATTTGTAGCAGGTGATTTTCCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.