TTBK2 Knockout Cell Line - CD BioSciences

service-banner

TTBK2 Knockout Cell Line

TTBK2 Knockout Cell Line

SPL-03757

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name TTBK2
Gene Abbr. TTBK2
Gene ID 146057
Full Name tau tubulin kinase 2
Alias SCA11, TTBK
Species Human
Genomic Locus chr15:42830009
Transcript NM_173500
WT Expression Level 4.02 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of TTBK2.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence CATTAGTACCACTCTCCGGC
PCR Primer Forward: TGTAAAACGACGGCCAGATTCTGTGCTCTGGATAGAAAAGGT
Reverse: AGTGAGAGGATCACAATTTGGGTAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.