Online Inquiry
TSPO Knockout Cell Line
SPL-03751
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 31bp deletion |
| Target Information | |
|---|---|
| Target Name | TSPO |
| Gene Abbr. | TSPO |
| Gene ID | 706 |
| Full Name | translocator protein |
| Alias | BPBS, BZRP, DBI, IBP, MBR |
| Species | Human |
| Genomic Locus | chr22:43159359 |
| Transcript | NM_000714 |
| WT Expression Level | 77.74 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein. [provided by RefSeq, Feb 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 31bp deletion in a coding exon of TSPO. |
| Description | 31bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGTGGGGCGGGTGCCACGA |
| PCR Primer |
Forward: CTGATCAGCTGACTGGTTGATCT Reverse: GAGGAGAAAGTTCAGTTGTGCAATC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.