Online Inquiry
TSC2 cDNA ORF Clone, Human, untagged
SPD-15297
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human tuberous sclerosis 2. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TSC2 |
| Gene Abbr. | TSC2 |
| Gene ID | 7249 |
| Full Name | TSC complex subunit 2 |
| Alias | LAM, PPP1R160, TSC4 |
| Introduction | Tuberin is a product of the TSC2 tumor suppressor gene and an important regulator of cell proliferation and tumor development. Mutations in either TSC2 or the related TSC1 (hamartin) gene cause tuberous sclerosis complex (TSC), an autosomal dominant disorder characterized by development of multiple, widespread non-malignant tumors. Tuberin is directly phosphorylated at Thr1462 by Akt/PKB. Phosphorylation at Thr1462 and Tyr1571 regulates tuberin-hamartin complexes and tuberin activity. In addition, tuberin inhibits the mammalian target of rapamycin (mTOR), which promotes inhibition of p70 S6 kinase, activation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1, an inhibitor of translation initiation), and eventual inhibition of translation.p38-activated kinase MK2 (MAPKAPK-2) phosphorylates Ser1254 of tuberin, and thus augments the interaction between tuberin and 14-3-3. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human tuberous sclerosis 2. |
| NCBI Ref Seq | NM_001077183.2 |
| RefSeq ORF Size | 5223 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6kb + 5.22kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.