TSC2 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

TSC2 cDNA ORF Clone, Human, untagged

TSC2 cDNA ORF Clone, Human, untagged

SPD-15296

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human tuberous sclerosis 2.
Target Information
Species Human
Target Name TSC2
Gene Abbr. TSC2
Gene ID 7249
Full Name TSC complex subunit 2
Alias LAM, PPP1R160, TSC4
Introduction Tuberin is a product of the TSC2 tumor suppressor gene and an important regulator of cell proliferation and tumor development. Mutations in either TSC2 or the related TSC1 (hamartin) gene cause tuberous sclerosis complex (TSC), an autosomal dominant disorder characterized by development of multiple, widespread non-malignant tumors. Tuberin is directly phosphorylated at Thr1462 by Akt/PKB. Phosphorylation at Thr1462 and Tyr1571 regulates tuberin-hamartin complexes and tuberin activity. In addition, tuberin inhibits the mammalian target of rapamycin (mTOR), which promotes inhibition of p70 S6 kinase, activation of eukaryotic initiation factor 4E binding protein 1 (4E-BP1, an inhibitor of translation initiation), and eventual inhibition of translation.p38-activated kinase MK2 (MAPKAPK-2) phosphorylates Ser1254 of tuberin, and thus augments the interaction between tuberin and 14-3-3.
Product Details
Description Full length Clone DNA of Human tuberous sclerosis 2.
NCBI Ref Seq XM_005255531.4
RefSeq ORF Size 5226 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6kb + 5.23kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.