Online Inquiry
TRIO Knockout Cell Line
SPL-03738
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | TRIO |
| Gene Abbr. | TRIO |
| Gene ID | 7204 |
| Full Name | trio Rho guanine nucleotide exchange factor |
| Alias | ARHGEF23, MEBAS, MRD44, MRD63, tgat |
| Species | Human |
| Genomic Locus | chr5:14280341 |
| Transcript | NM_007118 |
| WT Expression Level | 7.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of TRIO. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGGTCCCATTTTAACGTTTC |
| PCR Primer |
Forward: AGACAAGGCCATATGTAGTACCTTC Reverse: TAAATGTGACATCAGTGACAAGCAC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.