Online Inquiry
TRIM6 Knockout Cell Line
SPL-03734
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp insertion |
Target Information | |
---|---|
Target Name | TRIM6 |
Gene Abbr. | TRIM6 |
Gene ID | 117854 |
Full Name | tripartite motif containing 6 |
Alias | RNF89 |
Species | Human |
Genomic Locus | chr11:5605522 |
Transcript | NM_001003818 |
WT Expression Level | 11.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of TRIM6. |
Description | 1bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GGATCTGGAGCGTCGATGTC |
PCR Primer |
Forward: AATATCCTAGACAGAGTGGAGCAAC Reverse: TATAGCGCCAAAGGAATGTTTTCTC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.