TRIM4 Knockout Cell Line - CD BioSciences

service-banner

TRIM4 Knockout Cell Line

TRIM4 Knockout Cell Line

SPL-03730

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name TRIM4
Gene Abbr. TRIM4
Gene ID 89122
Full Name tripartite motif containing 4
Alias RNF87
Species Human
Genomic Locus chr7:99909630
Transcript NM_033091
WT Expression Level 16.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternatively spliced transcript variants that encode different isoforms have been described.[provided by RefSeq, Jul 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of TRIM4.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence TAAGTCTCAGCGTAATCTCG
PCR Primer Forward: CAAGAAATGTCCCAGACCAAAAGG
Reverse: TCATTCTCTGTTTTGATTAGGTGACT
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.