Online Inquiry
TRIM4 Knockout Cell Line
SPL-03730
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | TRIM4 |
| Gene Abbr. | TRIM4 |
| Gene ID | 89122 |
| Full Name | tripartite motif containing 4 |
| Alias | RNF87 |
| Species | Human |
| Genomic Locus | chr7:99909630 |
| Transcript | NM_033091 |
| WT Expression Level | 16.48 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Its function has not been identified. Alternatively spliced transcript variants that encode different isoforms have been described.[provided by RefSeq, Jul 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of TRIM4. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TAAGTCTCAGCGTAATCTCG |
| PCR Primer |
Forward: CAAGAAATGTCCCAGACCAAAAGG Reverse: TCATTCTCTGTTTTGATTAGGTGACT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.