Online Inquiry
TRIM27 Knockout Cell Line
SPL-03728
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 23bp deletion |
| Target Information | |
|---|---|
| Target Name | TRIM27 |
| Gene Abbr. | TRIM27 |
| Gene ID | 5987 |
| Full Name | tripartite motif containing 27 |
| Alias | RFP, RNF76 |
| Species | Human |
| Genomic Locus | chr6:28923429 |
| Transcript | NM_006510 |
| WT Expression Level | 41.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to the nuclear matrix. It interacts with the enhancer of polycomb protein and represses gene transcription. It is also thought to be involved in the differentiation of male germ cells. Fusion of the N-terminus of this protein with the truncated C-terminus of the RET gene product has been shown to result in production of the ret transforming protein. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of TRIM27. |
| Description | 23bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGAGGCACATGCGGCCCAAC |
| PCR Primer |
Forward: CTCCTCGCAGTACAGCTTCAG Reverse: GTACTTCGCAGAGCCCATGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.