Online Inquiry
TRIM26 Knockout Cell Line
SPL-03726
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 55bp deletion |
| Target Information | |
|---|---|
| Target Name | TRIM26 |
| Gene Abbr. | TRIM26 |
| Gene ID | 7726 |
| Full Name | tripartite motif containing 26 |
| Alias | AFP, RNF95, ZNF173 |
| Species | Human |
| Genomic Locus | chr6:30198887 |
| Transcript | NM_001242783 |
| WT Expression Level | 24.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Although the function of the protein is unknown, the RING domain suggests that the protein may have DNA-binding activity. The gene localizes to the major histocompatibility complex (MHC) class I region on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 55bp deletion in a coding exon of TRIM26. |
| Description | 55bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGCCAGTTGCCACACGGGT |
| PCR Primer |
Forward: TCCTCACAGTAGTAGTGCAGCTT Reverse: AGACCTCTCTGAACTAAGGATACCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.