TRIM24 Knockout Cell Line - CD BioSciences

service-banner

TRIM24 Knockout Cell Line

TRIM24 Knockout Cell Line

SPL-03724

Size Price
1 Unit Online Inquiry
Description
2bp deletion
Target Information
Target Name TRIM24
Gene Abbr. TRIM24
Gene ID 8805
Full Name tripartite motif containing 24
Alias PTC6, RNF82, TF1A, TIF1, TIF1A
Species Human
Genomic Locus chr7:138504382
Transcript NM_015905
WT Expression Level 29.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene mediates transcriptional control by interaction with the activation function 2 (AF2) region of several nuclear receptors, including the estrogen, retinoic acid, and vitamin D3 receptors. The protein localizes to nuclear bodies and is thought to associate with chromatin and heterochromatin-associated factors. The protein is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains - a RING, a B-box type 1 and a B-box type 2 - and a coiled-coil region. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of TRIM24.
Description 2bp deletion
Parental Cell Line C631
Guide RNA Sequence GACTTTTCTACTGTACTGCT
PCR Primer Forward: CAATTGTTTTTAAGTGACAGCAGGT
Reverse: TTGCCTCATCAATAGTTGGCAAAAA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.