Online Inquiry
TRIM24 Knockout Cell Line
SPL-03723
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | TRIM24 |
| Gene Abbr. | TRIM24 |
| Gene ID | 8805 |
| Full Name | tripartite motif containing 24 |
| Alias | PTC6, RNF82, TF1A, TIF1, TIF1A |
| Species | Human |
| Genomic Locus | chr7:138504382 |
| Transcript | NM_015905 |
| WT Expression Level | 29.45 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene mediates transcriptional control by interaction with the activation function 2 (AF2) region of several nuclear receptors, including the estrogen, retinoic acid, and vitamin D3 receptors. The protein localizes to nuclear bodies and is thought to associate with chromatin and heterochromatin-associated factors. The protein is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains - a RING, a B-box type 1 and a B-box type 2 - and a coiled-coil region. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of TRIM24. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GACTTTTCTACTGTACTGCT |
| PCR Primer |
Forward: CAATTGTTTTTAAGTGACAGCAGGT Reverse: TTGCCTCATCAATAGTTGGCAAAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.