Online Inquiry
TRIM23 Knockout Cell Line
SPL-03722
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | TRIM23 |
| Gene Abbr. | TRIM23 |
| Gene ID | 373 |
| Full Name | tripartite motif containing 23 |
| Alias | ARD1, ARFD1, RNF46 |
| Species | Human |
| Genomic Locus | chr5:65618099 |
| Transcript | NM_001656 |
| WT Expression Level | 8.88 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of TRIM23. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTGTTACTTGTCGATCAAAT |
| PCR Primer |
Forward: ACGTTTTTCTCAGGTGTCTTAAAGC Reverse: TCTTTTCTTTGCAAGGAGACAAAGTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.