Online Inquiry
TRIB3 Knockout Cell Line
SPL-03716
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
4bp deletion |
Target Information | |
---|---|
Target Name | TRIB3 |
Gene Abbr. | TRIB3 |
Gene ID | 57761 |
Full Name | tribbles pseudokinase 3 |
Alias | C20orf97, NIPK, SINK, SKIP3, TRB3 |
Species | Human |
Genomic Locus | chr20:388166 |
Transcript | NM_021158 |
WT Expression Level | 91.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. [provided by RefSeq, Jul 2014]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of TRIB3. |
Description | 4bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CACGATCTGGAGCAGTAGGT |
PCR Primer |
Forward: AGTTGGATGACAACTTAGATACCGA Reverse: GTACCTTGCAGGTATACTCAGTGC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.