TRIB3 Knockout Cell Line - CD BioSciences

service-banner

TRIB3 Knockout Cell Line

TRIB3 Knockout Cell Line

SPL-03715

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name TRIB3
Gene Abbr. TRIB3
Gene ID 57761
Full Name tribbles pseudokinase 3
Alias C20orf97, NIPK, SINK, SKIP3, TRB3
Species Human
Genomic Locus chr20:388166
Transcript NM_021158
WT Expression Level 91.81 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. Differential promoter usage and alternate splicing result in multiple transcript variants. [provided by RefSeq, Jul 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of TRIB3.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence CACGATCTGGAGCAGTAGGT
PCR Primer Forward: AGTTGGATGACAACTTAGATACCGA
Reverse: GTACCTTGCAGGTATACTCAGTGC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.