Online Inquiry
TREX1 Knockout Cell Line
SPL-03712
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
2bp deletion |
Target Information | |
---|---|
Target Name | TREX1 |
Gene Abbr. | TREX1 |
Gene ID | 11277 |
Full Name | three prime repair exonuclease 1 |
Alias | AGS1, CRV, DRN3, HERNS |
Species | Human |
Genomic Locus | chr3:48466691 |
Transcript | NM_016381 |
WT Expression Level | 2.31 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a nuclear protein with 3' exonuclease activity. The encoded protein may play a role in DNA repair and serve as a proofreading function for DNA polymerase. Mutations in this gene result in Aicardi-Goutieres syndrome, chilblain lupus, Cree encephalitis, and other diseases of the immune system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of TREX1. |
Description | 2bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GACCCTCATCTTTTTCGACA |
PCR Primer |
Forward: CTCTCCAACTTCCTGCCTGAAAAT Reverse: ACACACAGGGAGAGCTTGTCTA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.