Online Inquiry
TRDMT1 Knockout Cell Line
SPL-03707
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp deletion |
| Target Information | |
|---|---|
| Target Name | TRDMT1 |
| Gene Abbr. | TRDMT1 |
| Gene ID | 1787 |
| Full Name | tRNA aspartic acid methyltransferase 1 |
| Alias | DMNT2, DNMT2, MHSAIIP, PUMET, RNMT1 |
| Species | Human |
| Genomic Locus | chr10:17201604 |
| Transcript | NM_004412 |
| WT Expression Level | 7.57 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of TRDMT1. |
| Description | 1bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGTATAGCTCCAGCACCCGC |
| PCR Primer |
Forward: GGAGAAGGGAGTCAGCGTCT Reverse: TAGGAGACGGGGGAACTGAAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.