Online Inquiry
TRAF6 Knockout Cell Line
SPL-03705
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | TRAF6 |
| Gene Abbr. | TRAF6 |
| Gene ID | 7189 |
| Full Name | TNF receptor associated factor 6 |
| Alias | MGC:3310, RNF85 |
| Species | Human |
| Genomic Locus | chr11:36501392 |
| Transcript | NM_004620 |
| WT Expression Level | 5.05 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported. [provided by RefSeq, Feb 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of TRAF6. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGTGGGTGGAACTGCCAGCA |
| PCR Primer |
Forward: CTCTGCATCTGGTTCTGTTATAGGA Reverse: TTGCTATTTCTACAGAGCAAGTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.