Online Inquiry
Traf6 cDNA ORF Clone, Mouse, untagged
SPD-15150
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse TNF receptor-associated factor 6 |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | TRAF6 |
| Gene Abbr. | Traf6 |
| Gene ID | 22034 |
| Full Name | TNF receptor-associated factor 6 |
| Alias | 2310003F17Rik, AI851288, C630032O20Rik |
| Introduction | TRAFs (TNF receptor-associated factors) are a family of multifunctional adaptor proteins that bind to surface receptors and recruit additional proteins to form multiprotein signaling complexes capable of promoting cellular responses. Members of the TRAF family share a common carboxy-terminal "TRAF domain", which mediates interactions with associated proteins; many also contain amino-terminal Zinc/RING finger motifs. The first TRAFs identified, TRAF1 and TRAF2, were found by virtue of their interactions with the cytoplasmic domain of TNF-receptor 2 (TNFRII). The six known TRAFs (TRAF1-6) act as adaptor proteins for a wide range of cell surface receptors and participate in the regulation of cell survival, proliferation, differentiation, and stress responses.TRAF6 plays a critical role in innate and adaptive immunity, bone metabolism, and development of certain tissues including the nervous system.TRAF6 deficiency results in osteopetrosis and defective IL-1, CD40, and LPS signaling (6) as well as defects in neuronal development. Unlike other TRAF family members that mediate signaling through TNF, TRAF6 has unique binding activities (8) that result in signaling responses from the interleukin-1 receptor (IL-1R) toll-like receptor, CD40 RANK, and p75 neurotrophin receptor. TRAF6 associates directly with CD40 and RANK, and indirectly with IL-1R/TLR through IRAK. This leads to activation of NF-κB and MAP kinase signaling pathways through downstream association with the TAB/TAK-1 complex. TRAF6 also activates Src family nonreceptor tyrosine kinases leading to Akt activation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse TNF receptor-associated factor 6 |
| NCBI Ref Seq | NM_001303273.1 |
| RefSeq ORF Size | 1593 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.59kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.