Online Inquiry
TRAF5 cDNA ORF Clone, Human, C-FLAG tag
SPD-15148
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human TNF receptor-associated factor 5 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | TRAF5 |
| Gene Abbr. | TRAF5 |
| Gene ID | 7188 |
| Full Name | TNF receptor associated factor 5 |
| Alias | MGC:39780, RNF84 |
| Introduction | TRAFs (TNF receptor-associated factors) are a family of multifunctional adaptor proteins that bind to surface receptors and recruit additional proteins to form multiprotein signaling complexes capable of promoting cellular responses. Members of the TRAF family share a common carboxy-terminal "TRAF domain", which mediates interactions with associated proteins; many also contain amino-terminal Zinc/RING finger motifs. The first TRAFs identified, TRAF1 and TRAF2, were found by virtue of their interactions with the cytoplasmic domain of TNF-receptor 2 (TNFRII). The six known TRAFs (TRAF1-6) act as adaptor proteins for a wide range of cell surface receptors and participate in the regulation of cell survival, proliferation, differentiation, and stress responses.TRAF5 regulates signaling through binding to the cytoplasmic domains of TNFR famly members including CD40, CD27, CD30, OX40, and lymphotoxin-β receptor. Overexpression of TRAF5 induces NF-κB activation. Cytoplasmic aggregates of TRAF5, as well as TRAF2, were reported in Hodgkin-Reed-Sternberg cells, resulting in constitutive NF-κB activation.Studies of TRAF5 deficient mice suggest that it plays an important role in limiting Th2 immune responses that triggers T-cell mediated inflammatory diseases and asthma. Further studies indicate that TRAF5 binds to the IL-6 receptor gp130 and negatively controls Th17 differentation. In B-cells, TRAF5 negatively regulates toll-like receptor (TLR) mediated cytokine and antibody production. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human TNF receptor-associated factor 5 |
| NCBI Ref Seq | NM_001033910.2 |
| RefSeq ORF Size | 1713 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV mammalian cell promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI (two restriction sites) + XbaI (6kb + 0.38kb + 1.35kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.